Sanger sequencing services
- Purification of unpurified PCR products for Sanger sequencing
- Sanger sequencing (purified PCR products and plasmid samples)
Read length- Max 1000 bp read, on average 800 bp
- Recommended length for good quality data is above 120 bp
- Normal: 2 to 5 days, orders will be processed upon arrival and data sent when available in our LIMS.
- Prior: orders will be processed immediately upon arrival and data will be sent when run is finished (orders arrived before 15:00 will be processed the same day)
- Raw (ABI files), analyzed (text files), quality scores
- Data transfer via secured website (https) or attached to email
- Extra treatment for hairpin structures and high GC content
- UV/VIS template quantitation
- Fluorometric template quantitation
- Plasmid extraction and sequencing
- Genotyping services (only loading service)
- Use of primers provided by NSF (free of charge):
Name Sequence Full Name M13FS TGTAAAACGACGGCCAGT M13 Forward M13RS CAGGAAACAGCTATGACC M13 Reverse SP6 TATTTAGGTGACACTATAG SP6 primer T7 TAATACGACTCACTATAGGG T7 primer T7term TATGCTAGTTATTGCTCAG T7 terminator T3 ATTAACCCTCACTAAAGGGA T3 promotor - Free storage of customer primers
- Up to 3 months template storage
- Minimum of 6 months sequencing data storage
If you require loading service (fragment analysis), please deliver the reactions to the NSF in clearly labeled 96 well plates.
For the reactions, please use primers with fluorescent dyes FAM, VIC, NED, PET and/or LIZ.